Warning: fopen(/home/virtual/enm-kes/journal/upload/ip_log/ip_log_2026-05.txt): failed to open stream: Permission denied in /home/virtual/lib/view_data.php on line 100 Warning: fwrite() expects parameter 1 to be resource, boolean given in /home/virtual/lib/view_data.php on line 101 The Role of Nuclear Factor-E2-Related Factor 1 in the Oxidative Stress Response in MC3T3-E1 Osteoblastic Cells
Skip Navigation
Skip to contents

Endocrinol Metab : Endocrinology and Metabolism

clarivate
OPEN ACCESS
SEARCH
Search

Articles

Page Path
HOME > Endocrinol Metab > Volume 31(2); 2016 > Article
Original Article
Endocrine Research The Role of Nuclear Factor-E2-Related Factor 1 in the Oxidative Stress Response in MC3T3-E1 Osteoblastic Cells
So Young Park1orcid, Sung Hoon Kim1, Hyun Koo Yoon1, Chang Hoon Yim1, Sung-Kil Lim2
Endocrinology and Metabolism 2016;31(2):336-342.
DOI: https://doi.org/10.3803/EnM.2016.31.2.336
Published online: April 25, 2016

1Department of Internal Medicine, Cheil General Hospital & Women's Healthcare Center, Dankook University College of Medicine, Seoul, Korea.

2Division of Endocrinology and Metabolism, Department of Internal Medicine, Yonsei University College of Medicine, Seoul, Korea.

Corresponding author: Sung-Kil Lim. Department of Internal Medicine, Yonsei University College of Medicine, 50-1 Yonsei-ro, Seodaemun-gu, Seoul 03722, Korea. Tel: +82-2-2228-1948, Fax: +82-2-392-5548, lsk@yumc.yonsei.ac.kr
• Received: December 8, 2015   • Revised: January 4, 2016   • Accepted: January 12, 2016

Copyright © 2016 Korean Endocrine Society

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 7,051 Views
  • 64 Download
  • 15 Web of Science
  • 14 Crossref
  • 15 Scopus
prev next
  • Background
    Reactive oxygen species (ROS) and antioxidants are associated with maintenance of cellular function and metabolism. Nuclear factor-E2-related factor 1 (NFE2L1, Nrf1) is known to regulate the expression of a number of genes involved in oxidative stress and inflammation. The purpose of this study was to examine the effects of NFE2L1 on the response to oxidative stress in osteoblastic MC3T3-E1 cells.
  • Methods
    The murine calvaria-derived MC3T3-E1 cell line was exposed to lipopolysaccharide (LPS) for oxidative stress induction. NFE2L1 effects were evaluated using small interfering RNA (siRNA) for NFE2L1 mRNA. ROS generation and the levels of known antioxidant enzyme genes were assayed.
  • Results
    NFE2L1 expression was significantly increased 2.4-fold compared to the control group at 10 µg/mL LPS in MC3T3-E1 cells (P<0.05). LPS increased formation of intracellular ROS in MC3T3-E1 cells. NFE2L1 knockdown led to an additional increase of ROS (20%) in the group transfected with NFE2L1 siRNA compared with the control group under LPS stimulation (P<0.05). RNA interference of NFE2L1 suppressed the expression of antioxidant genes including metallothionein 2, glutamatecysteine ligase catalytic subunit, and glutathione peroxidase 1 in LPS-treated MC3T3-E1 cells.
  • Conclusion
    Our results suggest that NFE2L1 may have a distinct role in the regulation of antioxidant enzymes under inflammation-induced oxidative stress in MC3T3-E1 osteoblastic cells.
Reactive oxygen species (ROS) are considered to be a causal factor in inflammation, aging and a number of degenerative diseases such as atherosclerosis, carcinogenesis, infarction, and osteoporosis [1]. The effects of ROS are eliminated by enzymatic mechanisms involved in cellular antioxidant defense and xenobiotic detoxification [2]. The delicate balance between ROS and antioxidants is important to maintain equilibrium between osteoblasts and osteoclasts activities, respectively, under physiological conditions [3]. ROS and antioxidants are also known to be involved in the pathogenesis of bone loss such as in osteoporosis [45].
Lipopolysaccharide (LPS) is a constituent of the cell wall outer membrane of gram-negative bacteria and has various biological effects including immune and inflammatory responses [6]. LPS has the capacity to induce bone resorption in vitro and also stimulates osteoblasts to secrete osteolytic factors [7]. LPS is involved in the suppression of bone sialoprotein, a mineralized tissue-specific protein in osteoblast-like ROS 17/2.8 cells [8].
Nuclear factor-E2-related factor 1 (NFE2L1, Nrf1) is a basic leucine zipper protein (bZIP) in the Cap-N-Collar (CNC) transcriptional factor family and controls antioxidant response element (ARE)-driven genes [9]. NFE2L1 was originally suggested to have a role in β-globin gene expression in erythroid cells; however, NFE2L1 has also been shown to bind the ARE and regulate the expression of many genes involved in oxidative stress, cellular differentiation, and inflammation [10].
NFE2L1 can protect cells from oxidative stress by regulating genes encoding enzymes related to glutathione (GSH) biosynthesis and other oxidative defense enzymes [10]. Synthesis of GSH, a major antioxidant in the cell, involves γ-glutamylcysteine ligase (γ-GCL), which consists of a catalytic (GCLC) and a modifier (GCLM) light chain [11]. Evidence suggests that NFE2L1 regulates transcription of GSH synthesis-related genes and other antioxidant genes including NAD(P)H dehydrogenase, quinone 1 (NQO1), ferritin-H, metallothionein (MT)-1 and -2 in fibroblasts, and hepatocytes [12131415]. However, despite these observations, there have been no investigations of the function of NFE2L1 in oxidative stress and the NFE2L1-related antioxidant system in osteoblasts.
In the present study, we attempted to assess the effects of inflammation-induced oxidative stress on NFE2L1 expression pattern and also determined a role of NFE2L1 in the expressions of antioxidant-related enzymes using MC3T3-E1 osteoblastic cells.
Cell culture and treatment
The murine calvaria-derived MC3T3-E1 osteoblast-like cell line was used in this study. MC3T3-E1 cells were maintained in α-modified minimum essential medium (α-MEM) containing antibiotics and 10% fetal bovine serum. This basic medium was replenished every 3 days.
MC3T3-E1 cells were seeded in either 96- or 6-well plates. Cells were then treated with different concentrations of LPS (Sigma-Aldrich, St. Louis, MO, USA). Cells were subsequently washed twice with phosphate-buffered saline (PBS), and then cells were harvested for experiments.
Transfection of small interfering RNA
MC3T3-E1 cells were plated in either 96- or 6-well plates. After overnight culture, the cells were transfected using Lipofectamine PLUS reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Each transfection assay was performed with control small interfering RNA (siRNA) or NFE2L1 siRNA (siNFE2L1) (Santa Cruz Biotechnology, Santa Cruz, CA, USA).
RNA isolation and quantitative real-time polymerase chain reaction
Cultured cells were superficially washed with PBS, followed by extraction of total RNA using Trizol (Invitrogen) according to the manufacturer's standard instructions. Samples (2 µg) of total RNA were reverse transcribed, followed by oligo (dT) primer and MMLV Reverse Transcriptase (Promega Co., Madison, WI, USA) at a final volume of 25 µL. Aliquots of 2 µL cDNA were used as templates for real-time polymerase chain reaction (PCR). PCR amplification was performed with 2×SYBR Premix Ex Ta (Takara Bio Inc., Shiga, Japan) and 10 pmol forward and reverse primers using Thermal Cycler DICE Real Time System (Takara Bio Inc.). Reactions were performed for 45 cycles of 95℃ for 10 seconds, 60℃ for 15 seconds, and 72℃ for 30 seconds. Primers are listed in Table 1.
Measurement of intracellular ROS
Generation of intracellular ROS was measured according to the method described by Wang and Lou [16]. Briefly, MC3T3-E1 cells were cultured on 96-well plates (1×103 cells/well) and transfected with control siRNA (siCONT) or siNFE2L1. After 24 hours, cells were incubated in α-MEM containing fluorescent dye 50 µM H2DCF-DA (Invitrogen) for 15 minutes in the dark, washed thoroughly by PBS, and further incubated in α-MEM with or without 10 µg/mL LPS. The emitted fluorescence was measured by fluorometer (Wallac 1420D Fluorometer, PerkinElmer Inc., Turku, Finland) with excitation and emission wavelengths at 485 and 535 nm, respectively.
Statistical analysis
Statistical analysis was performed with SPSS version 11.5 (SPSS Inc., Chicago, IL, USA). Results are expressed as the mean±SE and the statistical significance was determined by Student t test or one-way analysis of variance with Tukey post hoc test. Significance was defined by a P<0.05.
NFE2L1 expression after LPS treatment
We examined the effect of LPS treatment on NFE2L1 mRNA expression in MC3T3-E1 cells (Fig. 1). Cells were treated with 0, 2, 5, or 10 µg/mL LPS for 24 hours. Although LPS treatment showed a trend to stimulate the expression of NFE2L1 gene in MC3T3-E1 cells dose-dependently, NFE2L1 expression was significantly increased 2.4-fold compared to the control group at 10 µg/mL LPS (P<0.05) (Fig. 1B).
RNA interference of NFE2L1
To investigate the contribution of NFE2L1 to the oxidative stress response in MC3T3-E1 cells, specific siRNA for NFE2L1 was transfected in MC3T3-E1 cells. Transfection with siNFE2L1 knocked down expression of NFE2L1 by 79% at 20 nm siRNA as determined by quantitative real time-PCR (P<0.05) (Fig. 2).
Effects of NFE2L1 knockdown on ROS formation in MC3T3-E1 cells
MC3T3-E1 cells transfected with siCONT or siNFE2L1 were treated with LPS (10 µg/ml) for 10 minutes, and ROS generation was subsequently analyzed (Fig. 3). Quiescent cells (without stimulation) displayed a similar level of ROS in both si-CONT and siNFE2L1 groups. LPS exposure resulted in a significant increase in the amount of ROS by 26% compared with unstimulated cells (P<0.05). The siNFE2L1 led to an additional increase of ROS (20%) compared with the siCONT group under LPS stimulation (P<0.05).
Effects of NFE2L1 knockdown on antioxidant gene expression in LPS treated cells
We next examined the effect of mRNA inhibition of NFE2L1 on the mRNA expression of antioxidant genes against oxidative stress in MC3T3-E1 cells. As shown in Fig. 4, there was no significant difference in antioxidant gene expression between siCONT and siNFE2L1 groups under unstimulated conditions. Exposure of MC3T3-E1 cells to LPS led to a significant increase in the level of MT2 compared to untreated controls, and NFE2L1 knockdown resulted in a decrease of 48% in MT2 expression under LPS stimulation (P<0.05) (Fig. 4B). In the presence of LPS, siNFE2L1 also significantly suppressed the expression of GCLC and glutathione peroxidase 1 (GPx1) by 41% and 37%, respectively, compared to the siCONT group (P<0.05) (Fig. 4C, F). However, the differences in mRNA levels of MT1, GCLM, and NQO1 between siCONT and siNFE2L1 groups following stimulation with LPS were not significant.
Bone remodeling is controlled by a wide range of systemic factors including hormones and steroids and local factors as well as bacterial products such as LPSs. Bacteria-induced pathological bone remodeling is related to bacterial arthritis, osteitis, osteomyelitis, and periodontitis [7]. Bone loss at sites of infection results from mainly increased formation and function of boneresorbing osteoclasts, though bacterially stimulated osteoblasts showed the ability to produce considerable inflammatory mediators that can promote osteoclastogenesis [17].
NFE2L1 is a member of the CNC family of bZIP transcriptional factors and plays an important role in the control of a wide range of genes involved in antioxidants, differentiation, and inflammation [10]. While an understanding of the role of NFE2L1 in the stress response has been demonstrated in various cells, it remains unclear whether NFE2L1 has unique functions under different conditions.
Here we found that expression of NFE2L1 was increased dose-dependently by LPS in MC3T3-E1 cells. LPS is known to have biologic effects to stimulate the production of cytokines such as interleukin 1 (IL-1), IL-6, and tumor necrosis factor α from osteoblasts [7] and these factors contribute to produce ROS in nonphagocytic cells [18]. We then observed that ROS generation by LPS was additionally increased after NFE2L1 silencing. Other studies have reported that NFE2L1-deficient hepatocytes and fibroblasts showed elevated free radicals under normal conditions and with cytotoxic agents, respectively [1219]. Our results suggest that osteoblasts could deal with the increased intracellular oxidative stress burden partially mediated by NFE2L1.
In this study, LPS treatment led to a strong induction of MT2 expression in MC3T3-E1 cells and functional inhibition of NFE2L1 by siRNA caused a significant decrease in expression of MT2 in the presence of LPS. The MT gene is known to be regulated transcriptionally in vivo by heavy metals, glucocorticoid hormones, and LPS [202122]. The level of MT2 expression is relatively higher than MT1, with the ratio of MT1 mRNA to MT2 mRNA ranging from 2:3 to 5:7 [23]. The mouse MT1 and MT2 genes are located in close proximity on chromosome 8 and are amplified together by heavy metals such as cadmium [2324]. Although the ARE of the mouse MT1 gene is preferentially regulated by NFE2L1 [15], the presence of two forms of MT genes could allow greater flexibility in the regulation of expression depending on the different types of inducers. Therefore, our study suggests that LPS might act as a strong inducer of MT2 expression in osteoblastic MC3T3-E1 cells, which is dominantly affected by NFE2L1 under oxidative stress.
We also observed that the expression of GCLC and GPx1 was affected after NFE2L1 knockdown under LPS stimulation. The mRNA expression of GPx1 and GCLC genes might be upregulated to a negligible extent with LPS-only treatment. Li et al. [25] reported that the levels of GPx were not changed in LPS-stimulated macrophages but significantly elevated in LPS-activated cells exposed to an antioxidative stress reagent. Previous studies have shown that GCLC and GPx1 were induced in response to overexpression of NFE2L1 or increased intracellular accumulation of NFE2L1 [1426]. The expression of GCLM and NQO1 was not changed by LPS and knockdown of NFE2L1, as NFE2L2 has been shown to primarily regulate GCLM and NQO1 [2728].
Our study has several limitations. First, oxidative stress could be induced by many agents such as H2O2, high glucose, cytotoxic drugs and metal; however, we focused on inflammation-induced oxidative stress using LPS. Second, we did not assess the association of NFE2L1 with forkhead homeobox type O-1, which is a crucial regulator of oxidative stress in osteoblasts [29]. Third, NFE2L1 is known to involve in cellular differentiation [3031]. It remains to be examined whether osteoblasts differentiation is affected by the change of NFE2L1 expression and antioxidant enzymes under LPS-induced oxidative stress. Finally, we only included the knock-down system of target gene, not performing over-expression system in this study.
In conclusion, this is the first study to elucidate the effects of NFE2L1 on inflammation-induced oxidative stress and the response of antioxidant enzymes in MC3T3-E1 cells. Our results show that the NFE2L1 gene is induced by LPS treatment and NFE2L1 mediates expression of antioxidant enzymes under oxidative stress induced by LPS in osteoblastic MC3T3-E1 cells. This work suggests that NFE2L1 has a distinct function in regulating the response to oxidative stress in osteoblastic cells.
Acknowledgements
This study was funded by the Korean Endocrine Society.

CONFLICTS OF INTEREST: No potential conflict of interest relevant to this article was reported.

  • 1. Banfi G, Iorio EL, Corsi MM. Oxidative stress, free radicals and bone remodeling. Clin Chem Lab Med 2008;46:1550–1555. ArticlePubMedPDF
  • 2. Lyakhovich VV, Vavilin VA, Zenkov NK, Menshchikova EB. Active defense under oxidative stress. The antioxidant responsive element. Biochemistry (Mosc) 2006;71:962–974. ArticlePubMedPDF
  • 3. Sheweita SA, Khoshhal KI. Calcium metabolism and oxidative stress in bone fractures: role of antioxidants. Curr Drug Metab 2007;8:519–525. ArticlePubMed
  • 4. Maggio D, Barabani M, Pierandrei M, Polidori MC, Catani M, Mecocci P, et al. Marked decrease in plasma antioxidants in aged osteoporotic women: results of a cross-sectional study. J Clin Endocrinol Metab 2003;88:1523–1527. ArticlePubMed
  • 5. Yalin S, Bagis S, Polat G, Dogruer N, Cenk Aksit S, Hatungil R, et al. Is there a role of free oxygen radicals in primary male osteoporosis? Clin Exp Rheumatol 2005;23:689–692. PubMed
  • 6. Schletter J, Heine H, Ulmer AJ, Rietschel ET. Molecular mechanisms of endotoxin activity. Arch Microbiol 1995;164:383–389. ArticlePubMedPDF
  • 7. Nair SP, Meghji S, Wilson M, Reddi K, White P, Henderson B. Bacterially induced bone destruction: mechanisms and misconceptions. Infect Immun 1996;64:2371–2380. ArticlePubMedPMC
  • 8. Kato N, Nakayama Y, Nakajima Y, Samoto H, Saito R, Yamanouchi F, et al. Regulation of bone sialoprotein (BSP) gene transcription by lipopolysaccharide. J Cell Biochem 2006;97:368–379. ArticlePubMed
  • 9. Chan JY, Han XL, Kan YW. Cloning of Nrf1, an NF-E2-related transcription factor, by genetic selection in yeast. Proc Natl Acad Sci U S A 1993;90:11371–11375. ArticlePubMedPMC
  • 10. Biswas M, Chan JY. Role of Nrf1 in antioxidant response element-mediated gene expression and beyond. Toxicol Appl Pharmacol 2010;244:16–20. ArticlePubMed
  • 11. Lu SC, Ge JL, Kuhlenkamp J, Kaplowitz N. Insulin and glucocorticoid dependence of hepatic gamma-glutamylcysteine synthetase and glutathione synthesis in the rat. Studies in cultured hepatocytes and in vivo. J Clin Invest 1992;90:524–532. ArticlePubMedPMC
  • 12. Kwong M, Kan YW, Chan JY. The CNC basic leucine zipper factor, Nrf1, is essential for cell survival in response to oxidative stress-inducing agents. Role for Nrf1 in gammagcs(l) and gss expression in mouse fibroblasts. J Biol Chem 1999;274:37491–37498. ArticlePubMed
  • 13. Lee TD, Yang H, Whang J, Lu SC. Cloning and characterization of the human glutathione synthetase 5'-flanking region. Biochem J 2005;390(Pt 2):521–528. ArticlePubMedPMCPDF
  • 14. Myhrstad MC, Husberg C, Murphy P, Nordstrom O, Blomhoff R, Moskaug JO, et al. TCF11/Nrf1 overexpression increases the intracellular glutathione level and can transactivate the gamma-glutamylcysteine synthetase (GCS) heavy subunit promoter. Biochim Biophys Acta 2001;1517:212–219. ArticlePubMed
  • 15. Ohtsuji M, Katsuoka F, Kobayashi A, Aburatani H, Hayes JD, Yamamoto M. Nrf1 and Nrf2 play distinct roles in activation of antioxidant response element-dependent genes. J Biol Chem 2008;283:33554–33562. ArticlePubMedPMC
  • 16. Wang Y, Lou MF. The regulation of NADPH oxidase and its association with cell proliferation in human lens epithelial cells. Invest Ophthalmol Vis Sci 2009;50:2291–2300. ArticlePubMed
  • 17. Marriott I. Osteoblast responses to bacterial pathogens: a previously unappreciated role for bone-forming cells in host defense and disease progression. Immunol Res 2004;30:291–308. ArticlePubMed
  • 18. Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, Telser J. Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol 2007;39:44–84. ArticlePubMed
  • 19. Chen L, Kwong M, Lu R, Ginzinger D, Lee C, Leung L, et al. Nrf1 is critical for redox balance and survival of liver cells during development. Mol Cell Biol 2003;23:4673–4686. ArticlePubMedPMC
  • 20. Durnam DM, Hoffman JS, Quaife CJ, Benditt EP, Chen HY, Brinster RL, et al. Induction of mouse metallothionein-I mRNA by bacterial endotoxin is independent of metals and glucocorticoid hormones. Proc Natl Acad Sci U S A 1984;81:1053–1056. ArticlePubMedPMC
  • 21. Durnam DM, Palmiter RD. Transcriptional regulation of the mouse metallothionein-I gene by heavy metals. J Biol Chem 1981;256:5712–5716. ArticlePubMed
  • 22. Mayo KE, Palmiter RD. Glucocorticoid regulation of metallothionein-I mRNA synthesis in cultured mouse cells. J Biol Chem 1981;256:2621–2624. ArticlePubMed
  • 23. Searle PF, Davison BL, Stuart GW, Wilkie TM, Norstedt G, Palmiter RD. Regulation, linkage, and sequence of mouse metallothionein I and II genes. Mol Cell Biol 1984;4:1221–1230. ArticlePubMedPMC
  • 24. Beach LR, Palmiter RD. Amplification of the metallothionein-I gene in cadmium-resistant mouse cells. Proc Natl Acad Sci U S A 1981;78:2110–2114. ArticlePubMedPMC
  • 25. Li DY, Xue MY, Geng ZR, Chen PY. The suppressive effects of Bursopentine (BP5) on oxidative stress and NF-κB activation in lipopolysaccharide-activated murine peritoneal macrophages. Cell Physiol Biochem 2012;29:9–20. ArticlePubMed
  • 26. Hernandez-Montes E, Pollard SE, Vauzour D, Jofre-Montseny L, Rota C, Rimbach G, et al. Activation of glutathione peroxidase via Nrf1 mediates genistein's protection against oxidative endothelial cell injury. Biochem Biophys Res Commun 2006;346:851–859. ArticlePubMed
  • 27. Ishii T, Itoh K, Takahashi S, Sato H, Yanagawa T, Katoh Y, et al. Transcription factor Nrf2 coordinately regulates a group of oxidative stress-inducible genes in macrophages. J Biol Chem 2000;275:16023–16029. ArticlePubMed
  • 28. Moinova HR, Mulcahy RT. Up-regulation of the human gamma-glutamylcysteine synthetase regulatory subunit gene involves binding of Nrf-2 to an electrophile responsive element. Biochem Biophys Res Commun 1999;261:661–668. ArticlePubMed
  • 29. Kousteni S. FoxOs: unifying links between oxidative stress and skeletal homeostasis. Curr Osteoporos Rep 2011;9:60–66. ArticlePubMedPDF
  • 30. Kim J, Xing W, Wergedal J, Chan JY, Mohan S. Targeted disruption of nuclear factor erythroid-derived 2-like 1 in osteoblasts reduces bone size and bone formation in mice. Physiol Genomics 2010;40:100–110. ArticlePubMed
  • 31. Xing W, Singgih A, Kapoor A, Alarcon CM, Baylink DJ, Mohan S. Nuclear factor-E2-related factor-1 mediates ascorbic acid induction of osterix expression via interaction with antioxidant-responsive element in bone cells. J Biol Chem 2007;282:22052–22061. ArticlePubMed
Fig. 1

The effect of lipopolysaccharide (LPS) on nuclear factor-E2-related factor 1 (NFE2L1) mRNA expression in MC3T3-E1 cells. Cells were treated with 0, 2, 5, or 10 µg/mL LPS for 24 hours. Levels of mRNA were analyzed by (A) semi-quantitative polymerase chain reaction (PCR) and (B) quantitative real time-PCR. The expression level of each mRNA was normalized to the β-actin levels. aP<0.05 compared with the control group.

enm-31-336-g001.jpg
Fig. 2

Nuclear factor-E2-related factor 1 (NFE2L1) mRNA expression after transient transfection with control siRNA (siCONT) or NFE2L1 siRNA (siNFE2L1) in MC3T3-E1 cells. Levels of mRNA were analyzed by semi-quantitative (A) polymerase chain reaction (PCR) and (B) quantitative real time-PCR. The expression level of each mRNA was normalized to the β-actin levels. aP<0.05 compared with the siCONT group.

enm-31-336-g002.jpg
Fig. 3

Measurement of reactive oxygen species (ROS) with H2DCF-DA in MC3T3-E1 cells. Intracellular ROS in the transfectants of control siRNA (siCONT) and nuclear factor-E2-related factor 1 siRNA (siNFE2L1) were compared under control (no stimulation) and stimulations by lipopolysaccharide (LPS, 10 µg/mL) for 10 minutes. aP<0.05 compared with the control group or siCONT cells.

enm-31-336-g003.jpg
Fig. 4

The effect of nuclear factor-E2-related factor 1 (NFE2L1) knockdown on antioxidant gene mRNA expression in lipopolysaccharide (LPS) treated cells. Antioxidant genes are as follows: (A) metallothionein 1 (MT1), (B) metallothionein 2 (MT2), (C) glutamate-cysteine ligase catalytic subunit (GCLC), (D) glutamate-cysteine ligase modifier subunit (GCLM), (E) NAD(P)H dehydrogenase, quinone 1 (NQO1), and (F) glutathione peroxidase 1 (GPx1). MC3T3-E1 cells were transfected with control siRNA (siCONT) or NFE2L1 siRNA (siNFE2L1) followed by 24-hour treatment of 10 µg/mL LPS. Controls received culture medium only. Quantitation of mRNA levels was analyzed by quantitative real-time polymerase chain reaction. The expression level of each mRNA was normalized to the β-actin levels. aP<0.05 compared with the control group or siCONT cells.

enm-31-336-g004.jpg
Table 1

Primers Used

enm-31-336-i001.jpg
Gene Forward (5'-3') Reverse (5'-3')
β-Actin CCGCGAGCACAGCTTCTT CCCACGATGGAGGGGAATAC
NFE2L1 GGAGAGCTTCCCTGCACAGT TTACTTCCATAGCCTGCATTTCC
MT1 ATGGACCCCAACTGCTCCT ACAGCCCTGGGCACATTT
MT2 CCGATCTCTCGTCGATCTTCAACC CAGGAGCAGCAGCTTTTCTTGCAG
GCLC GCACGGCATCCTCCAGTTCCT TCGGATGGTTGGGGTTTGTCC
GCLM GGCTTCGCCTCCGATTGAAGA TCACACAGCAGGAGGCCAGGT
NQO1 GCATTGGCCACACTCCACCAG ATGGCCCACAGAGAGGCCAAA
GPx1 TGCTCATTGAGAATGTCGCGTCTC AGGCATTCCGCAGGAAGGTAAAGA

NFE2L1, nuclear factor-E2-related factor 1; MT1, metallothionein 1; MT2, metallothionein 2; GCLC, glutamate-cysteine ligase catalytic subunit; GCLM, glutamate-cysteine ligase modifier subunit; NQO1, NAD(P)H dehydrogenase, quinone 1; GPx1, glutathione peroxidase 1.

Figure & Data

References

    Citations

    Citations to this article as recorded by  
    • Integrative analysis of quantitative trait loci of alternative polyadenylation and GWAS highlights key regulators of milk production and immune traits in Holstein
      Xinyue Tao, Yongjie Tang, Xueqin Liu, Miaozhuo Ni, Wanyi Lai, Siqian Chen, Ying Yu
      Animal Genetics.2026;[Epub]     CrossRef
    • Dual disease co-expression analysis reveals potential roles of estrogen-related genes in postmenopausal osteoporosis and Parkinson’s disease
      Dongdong Yu, Jian Kang, Chengguo Ju, Qingyan Wang, Ye Qiao, Long Qiao, Dongxiang Yang
      Frontiers in Genetics.2025;[Epub]     CrossRef
    • Inhibition of NFE2L1 Enables the Tumor‐Associated Macrophage Polarization and Enhances Anti‐PD1 Immunotherapy in Glioma
      Qun Zhang, Qiusi Tian, Rongzhen Deng, Keli Liu, Shiqun Chen, Shaofan Hu, Zhengwen Zhang, Hongzhao Lu, Yiguo Zhang
      CNS Neuroscience & Therapeutics.2025;[Epub]     CrossRef
    • Understanding the Transcription Factor NFE2L1/NRF1 from the Perspective of Hallmarks of Cancer
      Haomeng Zhang, Yong Liu, Ke Zhang, Zhixuan Hong, Zongfeng Liu, Zhe Liu, Guichen Li, Yuanyuan Xu, Jingbo Pi, Jingqi Fu, Yuanhong Xu
      Antioxidants.2024; 13(7): 758.     CrossRef
    • Multi-modal transcriptomic analysis reveals metabolic dysregulation and immune responses in chronic obstructive pulmonary disease
      Xiufang Luo, Wei Zeng, Jingyi Tang, Wang Liu, Jinyan Yang, Haiqing Chen, Lai Jiang, Xuancheng Zhou, Jinbang Huang, Shengke Zhang, Linjuan Du, Xiang Shen, Hao Chi, Huachuan Wang
      Scientific Reports.2024;[Epub]     CrossRef
    • SDH5 down-regulation mitigates the damage of osteoporosis via inhibiting the MyD88/NF-κB signaling pathway
      Hongzi Wu, Dehua Zhang, Haijun Xia, Yongqi Li, Feng Mao, Yi Liao
      Immunopharmacology and Immunotoxicology.2023; 45(3): 317.     CrossRef
    • N-acetyl Cysteine Inhibits Cell Proliferation and Differentiation of LPSInduced MC3T3-E1 Cells Via Regulating Inflammatory Cytokines
      Wangyang Li, Hui Zhang, Junchi Chen, Yujie Tan, Ailing Li, Ling Guo
      Current Pharmaceutical Biotechnology.2023; 24(3): 450.     CrossRef
    • Unravelling the role of NFE2L1 in stress responses and related diseases
      Xingzhu Liu, Chang Xu, Wanglong Xiao, Nianlong Yan
      Redox Biology.2023; 65: 102819.     CrossRef
    • Nfe2l1 deficiency mitigates streptozotocin-induced pancreatic β-cell destruction and development of diabetes in male mice
      Simeng Bao, Hongzhi Zheng, Chengjie Chen, Yuhang Zhang, Lina Bao, Bei Yang, Yongyong Hou, Yanyan Chen, Qiang Zhang, Jingbo Pi, Jingqi Fu
      Food and Chemical Toxicology.2021; 158: 112633.     CrossRef
    • Long isoforms of NRF1 negatively regulate adipogenesis via suppression of PPARγ expression
      Peng Xue, Yongyong Hou, Zhuo Zuo, Zhendi Wang, Suping Ren, Jian Dong, Jingqi Fu, Huihui Wang, Melvin E. Andersen, Qiang Zhang, Yuanyuan Xu, Jingbo Pi
      Redox Biology.2020; 30: 101414.     CrossRef
    • Protracted rosiglitazone treatment exacerbates inflammation in white adipose tissues of adipocyte-specific Nfe2l1 knockout mice
      Suping Ren, Yongyong Hou, Zhuo Zuo, Zhiyuan Liu, Huihui Wang, Yuanyuan Xu, Masayuki Yamamoto, Qiang Zhang, Jingqi Fu, Jingbo Pi
      Food and Chemical Toxicology.2020; 146: 111836.     CrossRef
    • Nrf1 is paved as a new strategic avenue to prevent and treat cancer, neurodegenerative and other diseases
      Jianxin Yuan, Shuwei Zhang, Yiguo Zhang
      Toxicology and Applied Pharmacology.2018; 360: 273.     CrossRef
    • Silencing of long isoforms of nuclear factor erythroid 2 like 1 primes macrophages towards M1 polarization
      Huihui Wang, Jiayu Zhu, Zhiyuan Liu, Hang Lv, Peng Lv, Feng Chen, Jingqi Fu, Yongyong Hou, Rui Zhao, Yuanyuan Xu, Qiang Zhang, Jingbo Pi
      Free Radical Biology and Medicine.2018; 117: 37.     CrossRef
    • Costunolide increases osteoblast differentiation via ATF4-dependent HO-1 expression in C3H10T1/2 cells
      Wan-Jin Jeon, Kyeong-Min Kim, Eun-Jung Kim, Won-Gu Jang
      Life Sciences.2017; 178: 94.     CrossRef

    • PubReader PubReader
    • Cite
      Cite
      export Copy Download
      Close
      Download Citation
      Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

      Format:
      • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
      • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
      Include:
      • Citation for the content below
      The Role of Nuclear Factor-E2-Related Factor 1 in the Oxidative Stress Response in MC3T3-E1 Osteoblastic Cells
      Endocrinol Metab. 2016;31(2):336-342.   Published online April 25, 2016
      Close
    • XML DownloadXML Download
    Figure
    • 0
    • 1
    • 2
    • 3
    The Role of Nuclear Factor-E2-Related Factor 1 in the Oxidative Stress Response in MC3T3-E1 Osteoblastic Cells
    Image Image Image Image
    Fig. 1 The effect of lipopolysaccharide (LPS) on nuclear factor-E2-related factor 1 (NFE2L1) mRNA expression in MC3T3-E1 cells. Cells were treated with 0, 2, 5, or 10 µg/mL LPS for 24 hours. Levels of mRNA were analyzed by (A) semi-quantitative polymerase chain reaction (PCR) and (B) quantitative real time-PCR. The expression level of each mRNA was normalized to the β-actin levels. aP<0.05 compared with the control group.
    Fig. 2 Nuclear factor-E2-related factor 1 (NFE2L1) mRNA expression after transient transfection with control siRNA (siCONT) or NFE2L1 siRNA (siNFE2L1) in MC3T3-E1 cells. Levels of mRNA were analyzed by semi-quantitative (A) polymerase chain reaction (PCR) and (B) quantitative real time-PCR. The expression level of each mRNA was normalized to the β-actin levels. aP<0.05 compared with the siCONT group.
    Fig. 3 Measurement of reactive oxygen species (ROS) with H2DCF-DA in MC3T3-E1 cells. Intracellular ROS in the transfectants of control siRNA (siCONT) and nuclear factor-E2-related factor 1 siRNA (siNFE2L1) were compared under control (no stimulation) and stimulations by lipopolysaccharide (LPS, 10 µg/mL) for 10 minutes. aP<0.05 compared with the control group or siCONT cells.
    Fig. 4 The effect of nuclear factor-E2-related factor 1 (NFE2L1) knockdown on antioxidant gene mRNA expression in lipopolysaccharide (LPS) treated cells. Antioxidant genes are as follows: (A) metallothionein 1 (MT1), (B) metallothionein 2 (MT2), (C) glutamate-cysteine ligase catalytic subunit (GCLC), (D) glutamate-cysteine ligase modifier subunit (GCLM), (E) NAD(P)H dehydrogenase, quinone 1 (NQO1), and (F) glutathione peroxidase 1 (GPx1). MC3T3-E1 cells were transfected with control siRNA (siCONT) or NFE2L1 siRNA (siNFE2L1) followed by 24-hour treatment of 10 µg/mL LPS. Controls received culture medium only. Quantitation of mRNA levels was analyzed by quantitative real-time polymerase chain reaction. The expression level of each mRNA was normalized to the β-actin levels. aP<0.05 compared with the control group or siCONT cells.
    The Role of Nuclear Factor-E2-Related Factor 1 in the Oxidative Stress Response in MC3T3-E1 Osteoblastic Cells
    GeneForward (5'-3')Reverse (5'-3')
    β-ActinCCGCGAGCACAGCTTCTTCCCACGATGGAGGGGAATAC
    NFE2L1GGAGAGCTTCCCTGCACAGTTTACTTCCATAGCCTGCATTTCC
    MT1ATGGACCCCAACTGCTCCTACAGCCCTGGGCACATTT
    MT2CCGATCTCTCGTCGATCTTCAACCCAGGAGCAGCAGCTTTTCTTGCAG
    GCLCGCACGGCATCCTCCAGTTCCTTCGGATGGTTGGGGTTTGTCC
    GCLMGGCTTCGCCTCCGATTGAAGATCACACAGCAGGAGGCCAGGT
    NQO1GCATTGGCCACACTCCACCAGATGGCCCACAGAGAGGCCAAA
    GPx1TGCTCATTGAGAATGTCGCGTCTCAGGCATTCCGCAGGAAGGTAAAGA
    Table 1 Primers Used

    NFE2L1, nuclear factor-E2-related factor 1; MT1, metallothionein 1; MT2, metallothionein 2; GCLC, glutamate-cysteine ligase catalytic subunit; GCLM, glutamate-cysteine ligase modifier subunit; NQO1, NAD(P)H dehydrogenase, quinone 1; GPx1, glutathione peroxidase 1.


    Endocrinol Metab : Endocrinology and Metabolism
    TOP